Report a Policy Violation
New deals posted everyday, starting Black Friday and running through the holiday season! No hassles, no lines - just awesome savings on art, deviantWEAR, Premium Memberships and more!
On this page, you can:
Start your own free art collection. Sign up here!Print Not Enabled(Shop Similar Prints)
See more of this artist:lorrainemd's profilelorrainemd's gallery
©2004-2009 ~lorrainemd
Artist's Comments
This was shot for a store of a friend, Ana, who has a store in Philly.
I loved this shoot! The clothes were amazing, the house was perfect, the model elegant and my team extraordinary. It's all in the details. Styling is everything. Romance is not dead.....it is just hiding. |
|
Site Map
Community News1890 deviantART Presents: The dAPRO Camera Bag!£deviantWEAR
 reports, 20h 26m agoDeviantART is proud to present the new dAPRO Camera Bag! With amazing quality and tons of features, it's perfect for all your photography needs. Watch our demo video to learn all about it! 136 Proposed Changes to the Terms of Service$chix0r
 reports, 6h 48m agoAs part of the BETA release of Groups, deviantART is exploring changes in its Terms of Service and Etiquette Policy. We'd like to share these proposed changes with you and get your feedback. Please read on! 86 Daily Literature Deviations- December 6, 2009=DailyLitDeviations
 reports, 1d 23h agoDaily Literature Deviations is a group that is dedicated to bringing literature to the forefront of the deviantArt community. We attempt to accomplish this by daily featuring Literature artists from around the community that deserve the recognition, but are not getting it. Each day we will feature 5 deviations from the Literature categories in a News Article. In order to support the artists that we feature, we ask that you  the news article as well as check out the individual pieces. We understand that each day you may not be able to check out each and every one of the pieces, everyone has their own things going on. We just ask that you make an attempt to help support the growing Literature community.76 Dreams & Nightmares photography contest*fhrankee
 reports, 1d 14h agoWe have decided to organize this contest to motivate people create more art. We would be happy if you would give it a try. You can think of anything you want, just make sure you still respect the theme. You can choose to illustrate dreams, nightmares or even both of them. Anything you want! Try not to be macabre if you are picturing “nightmares”. Respect the rules, have fun and most important, follow your heart! 75 Daily Literature Deviations - December 7, 2009=DailyLitDeviations
reports, 23h 45m agoDaily Literature Deviations is a group that is dedicated to bringing literature to the forefront of the deviantArt community. We attempt to accomplish this by daily featuring Literature artists from around the community that deserve the recognition, but are not getting it. Each day we will feature 5 deviations from the Literature categories in a News Article. In order to support the artists that we feature, we ask that you the news article as well as check out the individual pieces. We understand that each day you may not be able to check out each and every one of the pieces, everyone has their own things going on. We just ask that you make an attempt to help support the growing Literature community. |
PollDo you find the art of other deviants to be inspiring or intimidating? |
deviantART Loves You
Deviously serving the art and skin community for 3,410 days.
Only 242 days until our tenth birthday!
|
Deviousness
^Ikue has been a devious member of our community for almost 7 years and in this time he has proven to be nothing short of dedicated and devoted. Whilst volunteering his time over the last 22 months as a Gallery Moderator within the Community Relations Team, Chris has brought the Vector gallery and many vector artists directly into the spotlight. ^Ikue's commitment to the community is evident in everything he touches and you can always find him reaching out to others with an encouraging word. Chris is a natural leader with a vibrant and empathic personality, and is a role model for deviants everywhere. It's ev... Read More
|
Follow us on Twitter
Become a fan on Facebook
©2009 deviantART. All rights reserved
Comments
--
always de after pas
--
~ ATGATTCTAATCAAAGAAAGTTGTATTGAG AACTGCGAATAG!
Inspiring work!!!
--
"There is room for different point of view, different style, no matter how good of a photographer you are" 'gilad
--
{Life is nothing but a rocksong}
+fav
--
jorgeteixeira.com
--
"dying is an art, like everything else. I do it exceptionally well. I do it so it feels like hell. I do it so it feels real. I guess you could say I've a call."
-Sylvia Plath
my gallery [link]
Although these colours are nice, i think it could look better in b&w.
Congratulations to you and the whole team for this gorgeous composition.
--
"Mind is not a recipient to be filled, but a fire to be excited" (Plutarco)
Previous Page12345...Next Page